ID: 1091293449

View in Genome Browser
Species Human (GRCh38)
Location 11:134455501-134455523
Sequence TCTAAGTCACAGGATGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2547
Summary {0: 488, 1: 780, 2: 613, 3: 352, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091293447_1091293449 -8 Left 1091293447 11:134455486-134455508 CCATAGGTTAGGCATTCTAAGTC No data
Right 1091293449 11:134455501-134455523 TCTAAGTCACAGGATGAGATAGG 0: 488
1: 780
2: 613
3: 352
4: 314
1091293442_1091293449 20 Left 1091293442 11:134455458-134455480 CCTTGCTGAGACCTGCTGGGCTG No data
Right 1091293449 11:134455501-134455523 TCTAAGTCACAGGATGAGATAGG 0: 488
1: 780
2: 613
3: 352
4: 314
1091293443_1091293449 9 Left 1091293443 11:134455469-134455491 CCTGCTGGGCTGCACTCCCATAG No data
Right 1091293449 11:134455501-134455523 TCTAAGTCACAGGATGAGATAGG 0: 488
1: 780
2: 613
3: 352
4: 314
1091293446_1091293449 -7 Left 1091293446 11:134455485-134455507 CCCATAGGTTAGGCATTCTAAGT No data
Right 1091293449 11:134455501-134455523 TCTAAGTCACAGGATGAGATAGG 0: 488
1: 780
2: 613
3: 352
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091293449 Original CRISPR TCTAAGTCACAGGATGAGAT AGG Intergenic
Too many off-targets to display for this crispr