ID: 1091293450

View in Genome Browser
Species Human (GRCh38)
Location 11:134455504-134455526
Sequence AAGTCACAGGATGAGATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2571
Summary {0: 408, 1: 684, 2: 640, 3: 404, 4: 435}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091293447_1091293450 -5 Left 1091293447 11:134455486-134455508 CCATAGGTTAGGCATTCTAAGTC No data
Right 1091293450 11:134455504-134455526 AAGTCACAGGATGAGATAGGAGG 0: 408
1: 684
2: 640
3: 404
4: 435
1091293443_1091293450 12 Left 1091293443 11:134455469-134455491 CCTGCTGGGCTGCACTCCCATAG No data
Right 1091293450 11:134455504-134455526 AAGTCACAGGATGAGATAGGAGG 0: 408
1: 684
2: 640
3: 404
4: 435
1091293442_1091293450 23 Left 1091293442 11:134455458-134455480 CCTTGCTGAGACCTGCTGGGCTG No data
Right 1091293450 11:134455504-134455526 AAGTCACAGGATGAGATAGGAGG 0: 408
1: 684
2: 640
3: 404
4: 435
1091293446_1091293450 -4 Left 1091293446 11:134455485-134455507 CCCATAGGTTAGGCATTCTAAGT No data
Right 1091293450 11:134455504-134455526 AAGTCACAGGATGAGATAGGAGG 0: 408
1: 684
2: 640
3: 404
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091293450 Original CRISPR AAGTCACAGGATGAGATAGG AGG Intergenic
Too many off-targets to display for this crispr