ID: 1091293451

View in Genome Browser
Species Human (GRCh38)
Location 11:134455521-134455543
Sequence AGGAGGTCAGCACAAGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091293447_1091293451 12 Left 1091293447 11:134455486-134455508 CCATAGGTTAGGCATTCTAAGTC No data
Right 1091293451 11:134455521-134455543 AGGAGGTCAGCACAAGTTACAGG No data
1091293446_1091293451 13 Left 1091293446 11:134455485-134455507 CCCATAGGTTAGGCATTCTAAGT No data
Right 1091293451 11:134455521-134455543 AGGAGGTCAGCACAAGTTACAGG No data
1091293443_1091293451 29 Left 1091293443 11:134455469-134455491 CCTGCTGGGCTGCACTCCCATAG No data
Right 1091293451 11:134455521-134455543 AGGAGGTCAGCACAAGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091293451 Original CRISPR AGGAGGTCAGCACAAGTTAC AGG Intergenic
No off target data available for this crispr