ID: 1091294395

View in Genome Browser
Species Human (GRCh38)
Location 11:134463229-134463251
Sequence TACAATGCCCATTGTATAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091294393_1091294395 -9 Left 1091294393 11:134463215-134463237 CCTGGACAGTATCCTACAATGCC No data
Right 1091294395 11:134463229-134463251 TACAATGCCCATTGTATAGTAGG No data
1091294392_1091294395 -2 Left 1091294392 11:134463208-134463230 CCTATAGCCTGGACAGTATCCTA No data
Right 1091294395 11:134463229-134463251 TACAATGCCCATTGTATAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091294395 Original CRISPR TACAATGCCCATTGTATAGT AGG Intergenic
No off target data available for this crispr