ID: 1091294438

View in Genome Browser
Species Human (GRCh38)
Location 11:134463737-134463759
Sequence CTCAGTGTACCCTGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091294438_1091294443 3 Left 1091294438 11:134463737-134463759 CCAGGTTCCCAGGGTACACTGAG No data
Right 1091294443 11:134463763-134463785 CCCCTCCACCCCTTGAAGTAAGG No data
1091294438_1091294455 29 Left 1091294438 11:134463737-134463759 CCAGGTTCCCAGGGTACACTGAG No data
Right 1091294455 11:134463789-134463811 ACAGGGGCCCGCAGGGATGCTGG No data
1091294438_1091294452 13 Left 1091294438 11:134463737-134463759 CCAGGTTCCCAGGGTACACTGAG No data
Right 1091294452 11:134463773-134463795 CCTTGAAGTAAGGAACACAGGGG No data
1091294438_1091294450 12 Left 1091294438 11:134463737-134463759 CCAGGTTCCCAGGGTACACTGAG No data
Right 1091294450 11:134463772-134463794 CCCTTGAAGTAAGGAACACAGGG No data
1091294438_1091294448 11 Left 1091294438 11:134463737-134463759 CCAGGTTCCCAGGGTACACTGAG No data
Right 1091294448 11:134463771-134463793 CCCCTTGAAGTAAGGAACACAGG No data
1091294438_1091294454 22 Left 1091294438 11:134463737-134463759 CCAGGTTCCCAGGGTACACTGAG No data
Right 1091294454 11:134463782-134463804 AAGGAACACAGGGGCCCGCAGGG No data
1091294438_1091294453 21 Left 1091294438 11:134463737-134463759 CCAGGTTCCCAGGGTACACTGAG No data
Right 1091294453 11:134463781-134463803 TAAGGAACACAGGGGCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091294438 Original CRISPR CTCAGTGTACCCTGGGAACC TGG (reversed) Intergenic
No off target data available for this crispr