ID: 1091297132

View in Genome Browser
Species Human (GRCh38)
Location 11:134481942-134481964
Sequence CCCTGGGGCCCTGCCTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091297121_1091297132 30 Left 1091297121 11:134481889-134481911 CCTCAAGCCTGGGCTCCTAGGGT No data
Right 1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG No data
1091297124_1091297132 23 Left 1091297124 11:134481896-134481918 CCTGGGCTCCTAGGGTGTGGGTT No data
Right 1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG No data
1091297125_1091297132 15 Left 1091297125 11:134481904-134481926 CCTAGGGTGTGGGTTCTGAACGG No data
Right 1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091297132 Original CRISPR CCCTGGGGCCCTGCCTCTTC AGG Intergenic
No off target data available for this crispr