ID: 1091301285

View in Genome Browser
Species Human (GRCh38)
Location 11:134509757-134509779
Sequence GCTCACAGGAGACAGCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091301285_1091301295 20 Left 1091301285 11:134509757-134509779 CCTCCTAGCTGTCTCCTGTGAGC No data
Right 1091301295 11:134509800-134509822 TTGTGCCTTCTTTGAGGCCAGGG No data
1091301285_1091301294 19 Left 1091301285 11:134509757-134509779 CCTCCTAGCTGTCTCCTGTGAGC No data
Right 1091301294 11:134509799-134509821 ATTGTGCCTTCTTTGAGGCCAGG No data
1091301285_1091301292 14 Left 1091301285 11:134509757-134509779 CCTCCTAGCTGTCTCCTGTGAGC No data
Right 1091301292 11:134509794-134509816 GCCGCATTGTGCCTTCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091301285 Original CRISPR GCTCACAGGAGACAGCTAGG AGG (reversed) Intergenic
No off target data available for this crispr