ID: 1091302137

View in Genome Browser
Species Human (GRCh38)
Location 11:134514599-134514621
Sequence AGGGGCCTTGTGTAGACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091302137_1091302140 -10 Left 1091302137 11:134514599-134514621 CCACCAGTCTACACAAGGCCCCT No data
Right 1091302140 11:134514612-134514634 CAAGGCCCCTGAGTGTGTTAGGG No data
1091302137_1091302145 -1 Left 1091302137 11:134514599-134514621 CCACCAGTCTACACAAGGCCCCT No data
Right 1091302145 11:134514621-134514643 TGAGTGTGTTAGGGGTTCGCTGG No data
1091302137_1091302147 19 Left 1091302137 11:134514599-134514621 CCACCAGTCTACACAAGGCCCCT No data
Right 1091302147 11:134514641-134514663 TGGGCCCCCACATCCCCCTGTGG No data
1091302137_1091302146 0 Left 1091302137 11:134514599-134514621 CCACCAGTCTACACAAGGCCCCT No data
Right 1091302146 11:134514622-134514644 GAGTGTGTTAGGGGTTCGCTGGG No data
1091302137_1091302141 -9 Left 1091302137 11:134514599-134514621 CCACCAGTCTACACAAGGCCCCT No data
Right 1091302141 11:134514613-134514635 AAGGCCCCTGAGTGTGTTAGGGG No data
1091302137_1091302152 28 Left 1091302137 11:134514599-134514621 CCACCAGTCTACACAAGGCCCCT No data
Right 1091302152 11:134514650-134514672 ACATCCCCCTGTGGCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091302137 Original CRISPR AGGGGCCTTGTGTAGACTGG TGG (reversed) Intergenic
No off target data available for this crispr