ID: 1091304095

View in Genome Browser
Species Human (GRCh38)
Location 11:134525863-134525885
Sequence ACTCAATCCTGAATCTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091304095_1091304096 18 Left 1091304095 11:134525863-134525885 CCTGCATAGATTCAGGATTGAGT No data
Right 1091304096 11:134525904-134525926 ATGCCTGTAATCCCACACTTTGG 0: 101
1: 399
2: 1200
3: 2411
4: 4654
1091304095_1091304097 19 Left 1091304095 11:134525863-134525885 CCTGCATAGATTCAGGATTGAGT No data
Right 1091304097 11:134525905-134525927 TGCCTGTAATCCCACACTTTGGG 0: 110
1: 405
2: 1546
3: 13607
4: 138106
1091304095_1091304100 28 Left 1091304095 11:134525863-134525885 CCTGCATAGATTCAGGATTGAGT No data
Right 1091304100 11:134525914-134525936 TCCCACACTTTGGGAGGCCGAGG 0: 87
1: 929
2: 14013
3: 155844
4: 290869
1091304095_1091304099 22 Left 1091304095 11:134525863-134525885 CCTGCATAGATTCAGGATTGAGT No data
Right 1091304099 11:134525908-134525930 CTGTAATCCCACACTTTGGGAGG 0: 288
1: 748
2: 2135
3: 2673
4: 4188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091304095 Original CRISPR ACTCAATCCTGAATCTATGC AGG (reversed) Intergenic
No off target data available for this crispr