ID: 1091304245

View in Genome Browser
Species Human (GRCh38)
Location 11:134527330-134527352
Sequence ATGCTCCCCTTTAAAATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091304245_1091304246 -9 Left 1091304245 11:134527330-134527352 CCTGTGATTTTAAAGGGGAGCAT No data
Right 1091304246 11:134527344-134527366 GGGGAGCATCCTTTAGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091304245 Original CRISPR ATGCTCCCCTTTAAAATCAC AGG (reversed) Intergenic
No off target data available for this crispr