ID: 1091305204

View in Genome Browser
Species Human (GRCh38)
Location 11:134532030-134532052
Sequence CCCAAAAGAAGCCCATGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091305204_1091305213 21 Left 1091305204 11:134532030-134532052 CCTGCCCATGGGCTTCTTTTGGG No data
Right 1091305213 11:134532074-134532096 GGAATGTCTGTTTACGTGCCTGG No data
1091305204_1091305210 -1 Left 1091305204 11:134532030-134532052 CCTGCCCATGGGCTTCTTTTGGG No data
Right 1091305210 11:134532052-134532074 GGACATTTAGGACAAATCCGTGG No data
1091305204_1091305211 0 Left 1091305204 11:134532030-134532052 CCTGCCCATGGGCTTCTTTTGGG No data
Right 1091305211 11:134532053-134532075 GACATTTAGGACAAATCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091305204 Original CRISPR CCCAAAAGAAGCCCATGGGC AGG (reversed) Intergenic
No off target data available for this crispr