ID: 1091306245

View in Genome Browser
Species Human (GRCh38)
Location 11:134538100-134538122
Sequence TGAGCTCTGCAAACGTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091306241_1091306245 21 Left 1091306241 11:134538056-134538078 CCGTGGTGAGGCCGTCTGAGCAG No data
Right 1091306245 11:134538100-134538122 TGAGCTCTGCAAACGTCTGGTGG No data
1091306242_1091306245 10 Left 1091306242 11:134538067-134538089 CCGTCTGAGCAGAATCTGACTGA No data
Right 1091306245 11:134538100-134538122 TGAGCTCTGCAAACGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091306245 Original CRISPR TGAGCTCTGCAAACGTCTGG TGG Intergenic
No off target data available for this crispr