ID: 1091307264

View in Genome Browser
Species Human (GRCh38)
Location 11:134544270-134544292
Sequence TGCGTTGGTCGCCTGGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091307264_1091307271 27 Left 1091307264 11:134544270-134544292 CCCTCGGCCAGGCGACCAACGCA No data
Right 1091307271 11:134544320-134544342 ACTAAGTGCCCTTGAAGAGATGG No data
1091307264_1091307272 28 Left 1091307264 11:134544270-134544292 CCCTCGGCCAGGCGACCAACGCA No data
Right 1091307272 11:134544321-134544343 CTAAGTGCCCTTGAAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091307264 Original CRISPR TGCGTTGGTCGCCTGGCCGA GGG (reversed) Intergenic
No off target data available for this crispr