ID: 1091308557

View in Genome Browser
Species Human (GRCh38)
Location 11:134556811-134556833
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091308557_1091308558 -6 Left 1091308557 11:134556811-134556833 CCTACTGTCAAACAAGGCAGGTA No data
Right 1091308558 11:134556828-134556850 CAGGTAAGATCATTTCTTTGTGG No data
1091308557_1091308559 14 Left 1091308557 11:134556811-134556833 CCTACTGTCAAACAAGGCAGGTA No data
Right 1091308559 11:134556848-134556870 TGGCCAGTTTGTACACACATAGG No data
1091308557_1091308560 15 Left 1091308557 11:134556811-134556833 CCTACTGTCAAACAAGGCAGGTA No data
Right 1091308560 11:134556849-134556871 GGCCAGTTTGTACACACATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091308557 Original CRISPR TACCTGCCTTGTTTGACAGT AGG (reversed) Intergenic