ID: 1091308560

View in Genome Browser
Species Human (GRCh38)
Location 11:134556849-134556871
Sequence GGCCAGTTTGTACACACATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091308557_1091308560 15 Left 1091308557 11:134556811-134556833 CCTACTGTCAAACAAGGCAGGTA No data
Right 1091308560 11:134556849-134556871 GGCCAGTTTGTACACACATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091308560 Original CRISPR GGCCAGTTTGTACACACATA GGG Intergenic
No off target data available for this crispr