ID: 1091308563

View in Genome Browser
Species Human (GRCh38)
Location 11:134556886-134556908
Sequence GAGTCATATTTTAGGTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091308561_1091308563 12 Left 1091308561 11:134556851-134556873 CCAGTTTGTACACACATAGGGTA No data
Right 1091308563 11:134556886-134556908 GAGTCATATTTTAGGTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091308563 Original CRISPR GAGTCATATTTTAGGTTGTA TGG Intergenic
No off target data available for this crispr