ID: 1091308772

View in Genome Browser
Species Human (GRCh38)
Location 11:134558454-134558476
Sequence CTCGTTGGACTGATCTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091308772_1091308777 12 Left 1091308772 11:134558454-134558476 CCATTTCAGATCAGTCCAACGAG No data
Right 1091308777 11:134558489-134558511 CAGAACTGCTCATGGATGAAAGG No data
1091308772_1091308779 21 Left 1091308772 11:134558454-134558476 CCATTTCAGATCAGTCCAACGAG No data
Right 1091308779 11:134558498-134558520 TCATGGATGAAAGGGTACACTGG No data
1091308772_1091308778 13 Left 1091308772 11:134558454-134558476 CCATTTCAGATCAGTCCAACGAG No data
Right 1091308778 11:134558490-134558512 AGAACTGCTCATGGATGAAAGGG No data
1091308772_1091308780 22 Left 1091308772 11:134558454-134558476 CCATTTCAGATCAGTCCAACGAG No data
Right 1091308780 11:134558499-134558521 CATGGATGAAAGGGTACACTGGG No data
1091308772_1091308775 4 Left 1091308772 11:134558454-134558476 CCATTTCAGATCAGTCCAACGAG No data
Right 1091308775 11:134558481-134558503 CCTTGCCTCAGAACTGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091308772 Original CRISPR CTCGTTGGACTGATCTGAAA TGG (reversed) Intergenic
No off target data available for this crispr