ID: 1091309189

View in Genome Browser
Species Human (GRCh38)
Location 11:134560841-134560863
Sequence TTTTTTAAGCAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091309189_1091309197 24 Left 1091309189 11:134560841-134560863 CCCTCCTCCTCCTGCTTAAAAAA No data
Right 1091309197 11:134560888-134560910 GCAGTGCAGCAGCTTCGATGGGG No data
1091309189_1091309201 28 Left 1091309189 11:134560841-134560863 CCCTCCTCCTCCTGCTTAAAAAA No data
Right 1091309201 11:134560892-134560914 TGCAGCAGCTTCGATGGGGGGGG No data
1091309189_1091309199 26 Left 1091309189 11:134560841-134560863 CCCTCCTCCTCCTGCTTAAAAAA No data
Right 1091309199 11:134560890-134560912 AGTGCAGCAGCTTCGATGGGGGG No data
1091309189_1091309200 27 Left 1091309189 11:134560841-134560863 CCCTCCTCCTCCTGCTTAAAAAA No data
Right 1091309200 11:134560891-134560913 GTGCAGCAGCTTCGATGGGGGGG No data
1091309189_1091309195 22 Left 1091309189 11:134560841-134560863 CCCTCCTCCTCCTGCTTAAAAAA No data
Right 1091309195 11:134560886-134560908 CTGCAGTGCAGCAGCTTCGATGG No data
1091309189_1091309202 29 Left 1091309189 11:134560841-134560863 CCCTCCTCCTCCTGCTTAAAAAA No data
Right 1091309202 11:134560893-134560915 GCAGCAGCTTCGATGGGGGGGGG No data
1091309189_1091309198 25 Left 1091309189 11:134560841-134560863 CCCTCCTCCTCCTGCTTAAAAAA No data
Right 1091309198 11:134560889-134560911 CAGTGCAGCAGCTTCGATGGGGG No data
1091309189_1091309196 23 Left 1091309189 11:134560841-134560863 CCCTCCTCCTCCTGCTTAAAAAA No data
Right 1091309196 11:134560887-134560909 TGCAGTGCAGCAGCTTCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091309189 Original CRISPR TTTTTTAAGCAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr