ID: 1091311744

View in Genome Browser
Species Human (GRCh38)
Location 11:134579840-134579862
Sequence AGCCACTTGGGGCAGTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091311735_1091311744 14 Left 1091311735 11:134579803-134579825 CCCCTTGTCCTGGGAAATCCCTG No data
Right 1091311744 11:134579840-134579862 AGCCACTTGGGGCAGTGAACTGG No data
1091311736_1091311744 13 Left 1091311736 11:134579804-134579826 CCCTTGTCCTGGGAAATCCCTGT No data
Right 1091311744 11:134579840-134579862 AGCCACTTGGGGCAGTGAACTGG No data
1091311739_1091311744 -4 Left 1091311739 11:134579821-134579843 CCCTGTACAGTAAGAACACAGCC No data
Right 1091311744 11:134579840-134579862 AGCCACTTGGGGCAGTGAACTGG No data
1091311737_1091311744 12 Left 1091311737 11:134579805-134579827 CCTTGTCCTGGGAAATCCCTGTA No data
Right 1091311744 11:134579840-134579862 AGCCACTTGGGGCAGTGAACTGG No data
1091311740_1091311744 -5 Left 1091311740 11:134579822-134579844 CCTGTACAGTAAGAACACAGCCA No data
Right 1091311744 11:134579840-134579862 AGCCACTTGGGGCAGTGAACTGG No data
1091311738_1091311744 6 Left 1091311738 11:134579811-134579833 CCTGGGAAATCCCTGTACAGTAA No data
Right 1091311744 11:134579840-134579862 AGCCACTTGGGGCAGTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091311744 Original CRISPR AGCCACTTGGGGCAGTGAAC TGG Intergenic
No off target data available for this crispr