ID: 1091311840

View in Genome Browser
Species Human (GRCh38)
Location 11:134580454-134580476
Sequence CTGTGGGTGGGGAGCTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091311827_1091311840 16 Left 1091311827 11:134580415-134580437 CCCTCCCTGCAGATGGAATCTCT No data
Right 1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG No data
1091311830_1091311840 11 Left 1091311830 11:134580420-134580442 CCTGCAGATGGAATCTCTCTCCT No data
Right 1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG No data
1091311835_1091311840 -9 Left 1091311835 11:134580440-134580462 CCTGGAGCAGAGGTCTGTGGGTG No data
Right 1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG No data
1091311828_1091311840 15 Left 1091311828 11:134580416-134580438 CCTCCCTGCAGATGGAATCTCTC No data
Right 1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG No data
1091311829_1091311840 12 Left 1091311829 11:134580419-134580441 CCCTGCAGATGGAATCTCTCTCC No data
Right 1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG No data
1091311826_1091311840 22 Left 1091311826 11:134580409-134580431 CCAGCACCCTCCCTGCAGATGGA No data
Right 1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091311840 Original CRISPR CTGTGGGTGGGGAGCTCTGA GGG Intergenic
No off target data available for this crispr