ID: 1091317119

View in Genome Browser
Species Human (GRCh38)
Location 11:134622378-134622400
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091317115_1091317119 4 Left 1091317115 11:134622351-134622373 CCTCTAGTAAGAACTCTTGGGAA No data
Right 1091317119 11:134622378-134622400 GGAAGTATCGTCCTTTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091317119 Original CRISPR GGAAGTATCGTCCTTTGTAG GGG Intergenic
No off target data available for this crispr