ID: 1091317344

View in Genome Browser
Species Human (GRCh38)
Location 11:134623917-134623939
Sequence CTGGGGCTGGGACTTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091317344_1091317357 25 Left 1091317344 11:134623917-134623939 CCCAACACAAGTCCCAGCCCCAG No data
Right 1091317357 11:134623965-134623987 ACAGACCCTGGATCTCATTCAGG No data
1091317344_1091317354 13 Left 1091317344 11:134623917-134623939 CCCAACACAAGTCCCAGCCCCAG No data
Right 1091317354 11:134623953-134623975 TGCTGCCCAAGGACAGACCCTGG No data
1091317344_1091317352 2 Left 1091317344 11:134623917-134623939 CCCAACACAAGTCCCAGCCCCAG No data
Right 1091317352 11:134623942-134623964 CTTACCTGGAATGCTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091317344 Original CRISPR CTGGGGCTGGGACTTGTGTT GGG (reversed) Intergenic
No off target data available for this crispr