ID: 1091318013

View in Genome Browser
Species Human (GRCh38)
Location 11:134629315-134629337
Sequence CTGGATTAAAAAATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2325
Summary {0: 2, 1: 2, 2: 43, 3: 346, 4: 1932}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091318010_1091318013 23 Left 1091318010 11:134629269-134629291 CCTGCAGTTCTCATTTTCAAATC No data
Right 1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG 0: 2
1: 2
2: 43
3: 346
4: 1932
1091318009_1091318013 24 Left 1091318009 11:134629268-134629290 CCCTGCAGTTCTCATTTTCAAAT No data
Right 1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG 0: 2
1: 2
2: 43
3: 346
4: 1932
1091318008_1091318013 25 Left 1091318008 11:134629267-134629289 CCCCTGCAGTTCTCATTTTCAAA No data
Right 1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG 0: 2
1: 2
2: 43
3: 346
4: 1932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091318013 Original CRISPR CTGGATTAAAAAATGGACAA AGG Intergenic
Too many off-targets to display for this crispr