ID: 1091321164

View in Genome Browser
Species Human (GRCh38)
Location 11:134652975-134652997
Sequence CACTCTCAAGGGTTGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091321164_1091321171 4 Left 1091321164 11:134652975-134652997 CCTTCCCACAACCCTTGAGAGTG No data
Right 1091321171 11:134653002-134653024 CAAGTCTGGGTGCTTCATCACGG No data
1091321164_1091321169 -10 Left 1091321164 11:134652975-134652997 CCTTCCCACAACCCTTGAGAGTG No data
Right 1091321169 11:134652988-134653010 CTTGAGAGTGTGAACAAGTCTGG No data
1091321164_1091321172 14 Left 1091321164 11:134652975-134652997 CCTTCCCACAACCCTTGAGAGTG No data
Right 1091321172 11:134653012-134653034 TGCTTCATCACGGCACTGCAAGG No data
1091321164_1091321170 -9 Left 1091321164 11:134652975-134652997 CCTTCCCACAACCCTTGAGAGTG No data
Right 1091321170 11:134652989-134653011 TTGAGAGTGTGAACAAGTCTGGG No data
1091321164_1091321174 27 Left 1091321164 11:134652975-134652997 CCTTCCCACAACCCTTGAGAGTG No data
Right 1091321174 11:134653025-134653047 CACTGCAAGGGCAGAAATCAAGG No data
1091321164_1091321173 15 Left 1091321164 11:134652975-134652997 CCTTCCCACAACCCTTGAGAGTG No data
Right 1091321173 11:134653013-134653035 GCTTCATCACGGCACTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091321164 Original CRISPR CACTCTCAAGGGTTGTGGGA AGG (reversed) Intergenic
No off target data available for this crispr