ID: 1091321854

View in Genome Browser
Species Human (GRCh38)
Location 11:134657388-134657410
Sequence CAGCCCGGAGACCAGCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091321837_1091321854 27 Left 1091321837 11:134657338-134657360 CCTCCTGACCGACTCCATGGGGT No data
Right 1091321854 11:134657388-134657410 CAGCCCGGAGACCAGCCCGCAGG No data
1091321845_1091321854 1 Left 1091321845 11:134657364-134657386 CCTCAGGGCCTCCCAGGACCCGC No data
Right 1091321854 11:134657388-134657410 CAGCCCGGAGACCAGCCCGCAGG No data
1091321846_1091321854 -7 Left 1091321846 11:134657372-134657394 CCTCCCAGGACCCGCCCAGCCCG No data
Right 1091321854 11:134657388-134657410 CAGCCCGGAGACCAGCCCGCAGG No data
1091321843_1091321854 13 Left 1091321843 11:134657352-134657374 CCATGGGGTTGGCCTCAGGGCCT No data
Right 1091321854 11:134657388-134657410 CAGCCCGGAGACCAGCCCGCAGG No data
1091321848_1091321854 -10 Left 1091321848 11:134657375-134657397 CCCAGGACCCGCCCAGCCCGGAG No data
Right 1091321854 11:134657388-134657410 CAGCCCGGAGACCAGCCCGCAGG No data
1091321838_1091321854 24 Left 1091321838 11:134657341-134657363 CCTGACCGACTCCATGGGGTTGG No data
Right 1091321854 11:134657388-134657410 CAGCCCGGAGACCAGCCCGCAGG No data
1091321840_1091321854 19 Left 1091321840 11:134657346-134657368 CCGACTCCATGGGGTTGGCCTCA No data
Right 1091321854 11:134657388-134657410 CAGCCCGGAGACCAGCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091321854 Original CRISPR CAGCCCGGAGACCAGCCCGC AGG Intergenic
No off target data available for this crispr