ID: 1091322534

View in Genome Browser
Species Human (GRCh38)
Location 11:134662259-134662281
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091322532_1091322534 -3 Left 1091322532 11:134662239-134662261 CCTGATACACTAATTCTGTTGAG No data
Right 1091322534 11:134662259-134662281 GAGTTACCGGCCACAATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091322534 Original CRISPR GAGTTACCGGCCACAATTAA AGG Intergenic