ID: 1091324696

View in Genome Browser
Species Human (GRCh38)
Location 11:134677470-134677492
Sequence GGAGGTTGGCGGCCTGACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091324696_1091324706 23 Left 1091324696 11:134677470-134677492 CCGGGGTCAGGCCGCCAACCTCC No data
Right 1091324706 11:134677516-134677538 GAGCCCTCTCTCTAGGCAGGAGG No data
1091324696_1091324705 20 Left 1091324696 11:134677470-134677492 CCGGGGTCAGGCCGCCAACCTCC No data
Right 1091324705 11:134677513-134677535 TCAGAGCCCTCTCTCTAGGCAGG No data
1091324696_1091324707 24 Left 1091324696 11:134677470-134677492 CCGGGGTCAGGCCGCCAACCTCC No data
Right 1091324707 11:134677517-134677539 AGCCCTCTCTCTAGGCAGGAGGG No data
1091324696_1091324704 16 Left 1091324696 11:134677470-134677492 CCGGGGTCAGGCCGCCAACCTCC No data
Right 1091324704 11:134677509-134677531 TTCATCAGAGCCCTCTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091324696 Original CRISPR GGAGGTTGGCGGCCTGACCC CGG (reversed) Intergenic
No off target data available for this crispr