ID: 1091324697

View in Genome Browser
Species Human (GRCh38)
Location 11:134677481-134677503
Sequence AGGAGGGAACAGGAGGTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091324697_1091324711 23 Left 1091324697 11:134677481-134677503 CCGCCAACCTCCTGTTCCCTCCT No data
Right 1091324711 11:134677527-134677549 CTAGGCAGGAGGGCCTTCCTGGG No data
1091324697_1091324712 24 Left 1091324697 11:134677481-134677503 CCGCCAACCTCCTGTTCCCTCCT No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data
1091324697_1091324713 25 Left 1091324697 11:134677481-134677503 CCGCCAACCTCCTGTTCCCTCCT No data
Right 1091324713 11:134677529-134677551 AGGCAGGAGGGCCTTCCTGGGGG No data
1091324697_1091324710 22 Left 1091324697 11:134677481-134677503 CCGCCAACCTCCTGTTCCCTCCT No data
Right 1091324710 11:134677526-134677548 TCTAGGCAGGAGGGCCTTCCTGG No data
1091324697_1091324704 5 Left 1091324697 11:134677481-134677503 CCGCCAACCTCCTGTTCCCTCCT No data
Right 1091324704 11:134677509-134677531 TTCATCAGAGCCCTCTCTCTAGG No data
1091324697_1091324706 12 Left 1091324697 11:134677481-134677503 CCGCCAACCTCCTGTTCCCTCCT No data
Right 1091324706 11:134677516-134677538 GAGCCCTCTCTCTAGGCAGGAGG No data
1091324697_1091324705 9 Left 1091324697 11:134677481-134677503 CCGCCAACCTCCTGTTCCCTCCT No data
Right 1091324705 11:134677513-134677535 TCAGAGCCCTCTCTCTAGGCAGG No data
1091324697_1091324707 13 Left 1091324697 11:134677481-134677503 CCGCCAACCTCCTGTTCCCTCCT No data
Right 1091324707 11:134677517-134677539 AGCCCTCTCTCTAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091324697 Original CRISPR AGGAGGGAACAGGAGGTTGG CGG (reversed) Intergenic
No off target data available for this crispr