ID: 1091324698

View in Genome Browser
Species Human (GRCh38)
Location 11:134677484-134677506
Sequence GAGAGGAGGGAACAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091324698_1091324712 21 Left 1091324698 11:134677484-134677506 CCAACCTCCTGTTCCCTCCTCTC No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data
1091324698_1091324711 20 Left 1091324698 11:134677484-134677506 CCAACCTCCTGTTCCCTCCTCTC No data
Right 1091324711 11:134677527-134677549 CTAGGCAGGAGGGCCTTCCTGGG No data
1091324698_1091324707 10 Left 1091324698 11:134677484-134677506 CCAACCTCCTGTTCCCTCCTCTC No data
Right 1091324707 11:134677517-134677539 AGCCCTCTCTCTAGGCAGGAGGG No data
1091324698_1091324706 9 Left 1091324698 11:134677484-134677506 CCAACCTCCTGTTCCCTCCTCTC No data
Right 1091324706 11:134677516-134677538 GAGCCCTCTCTCTAGGCAGGAGG No data
1091324698_1091324713 22 Left 1091324698 11:134677484-134677506 CCAACCTCCTGTTCCCTCCTCTC No data
Right 1091324713 11:134677529-134677551 AGGCAGGAGGGCCTTCCTGGGGG No data
1091324698_1091324704 2 Left 1091324698 11:134677484-134677506 CCAACCTCCTGTTCCCTCCTCTC No data
Right 1091324704 11:134677509-134677531 TTCATCAGAGCCCTCTCTCTAGG No data
1091324698_1091324710 19 Left 1091324698 11:134677484-134677506 CCAACCTCCTGTTCCCTCCTCTC No data
Right 1091324710 11:134677526-134677548 TCTAGGCAGGAGGGCCTTCCTGG No data
1091324698_1091324705 6 Left 1091324698 11:134677484-134677506 CCAACCTCCTGTTCCCTCCTCTC No data
Right 1091324705 11:134677513-134677535 TCAGAGCCCTCTCTCTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091324698 Original CRISPR GAGAGGAGGGAACAGGAGGT TGG (reversed) Intergenic