ID: 1091324700

View in Genome Browser
Species Human (GRCh38)
Location 11:134677491-134677513
Sequence ATGAACAGAGAGGAGGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091324700_1091324711 13 Left 1091324700 11:134677491-134677513 CCTGTTCCCTCCTCTCTGTTCAT No data
Right 1091324711 11:134677527-134677549 CTAGGCAGGAGGGCCTTCCTGGG No data
1091324700_1091324705 -1 Left 1091324700 11:134677491-134677513 CCTGTTCCCTCCTCTCTGTTCAT No data
Right 1091324705 11:134677513-134677535 TCAGAGCCCTCTCTCTAGGCAGG No data
1091324700_1091324713 15 Left 1091324700 11:134677491-134677513 CCTGTTCCCTCCTCTCTGTTCAT No data
Right 1091324713 11:134677529-134677551 AGGCAGGAGGGCCTTCCTGGGGG No data
1091324700_1091324707 3 Left 1091324700 11:134677491-134677513 CCTGTTCCCTCCTCTCTGTTCAT No data
Right 1091324707 11:134677517-134677539 AGCCCTCTCTCTAGGCAGGAGGG No data
1091324700_1091324704 -5 Left 1091324700 11:134677491-134677513 CCTGTTCCCTCCTCTCTGTTCAT No data
Right 1091324704 11:134677509-134677531 TTCATCAGAGCCCTCTCTCTAGG No data
1091324700_1091324706 2 Left 1091324700 11:134677491-134677513 CCTGTTCCCTCCTCTCTGTTCAT No data
Right 1091324706 11:134677516-134677538 GAGCCCTCTCTCTAGGCAGGAGG No data
1091324700_1091324712 14 Left 1091324700 11:134677491-134677513 CCTGTTCCCTCCTCTCTGTTCAT No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data
1091324700_1091324710 12 Left 1091324700 11:134677491-134677513 CCTGTTCCCTCCTCTCTGTTCAT No data
Right 1091324710 11:134677526-134677548 TCTAGGCAGGAGGGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091324700 Original CRISPR ATGAACAGAGAGGAGGGAAC AGG (reversed) Intergenic