ID: 1091324703

View in Genome Browser
Species Human (GRCh38)
Location 11:134677501-134677523
Sequence GAGGGCTCTGATGAACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091324703_1091324716 30 Left 1091324703 11:134677501-134677523 CCTCTCTGTTCATCAGAGCCCTC No data
Right 1091324716 11:134677554-134677576 GCTGTGTCCTCCCTCATGTCAGG No data
1091324703_1091324712 4 Left 1091324703 11:134677501-134677523 CCTCTCTGTTCATCAGAGCCCTC No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data
1091324703_1091324713 5 Left 1091324703 11:134677501-134677523 CCTCTCTGTTCATCAGAGCCCTC No data
Right 1091324713 11:134677529-134677551 AGGCAGGAGGGCCTTCCTGGGGG No data
1091324703_1091324707 -7 Left 1091324703 11:134677501-134677523 CCTCTCTGTTCATCAGAGCCCTC No data
Right 1091324707 11:134677517-134677539 AGCCCTCTCTCTAGGCAGGAGGG No data
1091324703_1091324710 2 Left 1091324703 11:134677501-134677523 CCTCTCTGTTCATCAGAGCCCTC No data
Right 1091324710 11:134677526-134677548 TCTAGGCAGGAGGGCCTTCCTGG No data
1091324703_1091324706 -8 Left 1091324703 11:134677501-134677523 CCTCTCTGTTCATCAGAGCCCTC No data
Right 1091324706 11:134677516-134677538 GAGCCCTCTCTCTAGGCAGGAGG No data
1091324703_1091324711 3 Left 1091324703 11:134677501-134677523 CCTCTCTGTTCATCAGAGCCCTC No data
Right 1091324711 11:134677527-134677549 CTAGGCAGGAGGGCCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091324703 Original CRISPR GAGGGCTCTGATGAACAGAG AGG (reversed) Intergenic