ID: 1091324704

View in Genome Browser
Species Human (GRCh38)
Location 11:134677509-134677531
Sequence TTCATCAGAGCCCTCTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091324698_1091324704 2 Left 1091324698 11:134677484-134677506 CCAACCTCCTGTTCCCTCCTCTC No data
Right 1091324704 11:134677509-134677531 TTCATCAGAGCCCTCTCTCTAGG No data
1091324699_1091324704 -2 Left 1091324699 11:134677488-134677510 CCTCCTGTTCCCTCCTCTCTGTT No data
Right 1091324704 11:134677509-134677531 TTCATCAGAGCCCTCTCTCTAGG No data
1091324696_1091324704 16 Left 1091324696 11:134677470-134677492 CCGGGGTCAGGCCGCCAACCTCC No data
Right 1091324704 11:134677509-134677531 TTCATCAGAGCCCTCTCTCTAGG No data
1091324700_1091324704 -5 Left 1091324700 11:134677491-134677513 CCTGTTCCCTCCTCTCTGTTCAT No data
Right 1091324704 11:134677509-134677531 TTCATCAGAGCCCTCTCTCTAGG No data
1091324697_1091324704 5 Left 1091324697 11:134677481-134677503 CCGCCAACCTCCTGTTCCCTCCT No data
Right 1091324704 11:134677509-134677531 TTCATCAGAGCCCTCTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091324704 Original CRISPR TTCATCAGAGCCCTCTCTCT AGG Intergenic
No off target data available for this crispr