ID: 1091324712

View in Genome Browser
Species Human (GRCh38)
Location 11:134677528-134677550
Sequence TAGGCAGGAGGGCCTTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091324700_1091324712 14 Left 1091324700 11:134677491-134677513 CCTGTTCCCTCCTCTCTGTTCAT No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data
1091324703_1091324712 4 Left 1091324703 11:134677501-134677523 CCTCTCTGTTCATCAGAGCCCTC No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data
1091324701_1091324712 8 Left 1091324701 11:134677497-134677519 CCCTCCTCTCTGTTCATCAGAGC No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data
1091324698_1091324712 21 Left 1091324698 11:134677484-134677506 CCAACCTCCTGTTCCCTCCTCTC No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data
1091324697_1091324712 24 Left 1091324697 11:134677481-134677503 CCGCCAACCTCCTGTTCCCTCCT No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data
1091324699_1091324712 17 Left 1091324699 11:134677488-134677510 CCTCCTGTTCCCTCCTCTCTGTT No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data
1091324702_1091324712 7 Left 1091324702 11:134677498-134677520 CCTCCTCTCTGTTCATCAGAGCC No data
Right 1091324712 11:134677528-134677550 TAGGCAGGAGGGCCTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091324712 Original CRISPR TAGGCAGGAGGGCCTTCCTG GGG Intergenic
No off target data available for this crispr