ID: 1091325419

View in Genome Browser
Species Human (GRCh38)
Location 11:134683384-134683406
Sequence CACGTGTGGAATTTCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091325419_1091325427 25 Left 1091325419 11:134683384-134683406 CCCACCAGGAAATTCCACACGTG No data
Right 1091325427 11:134683432-134683454 CATTGCAGTCTGTGGGCTCCTGG No data
1091325419_1091325423 17 Left 1091325419 11:134683384-134683406 CCCACCAGGAAATTCCACACGTG No data
Right 1091325423 11:134683424-134683446 CTGTCGCCCATTGCAGTCTGTGG No data
1091325419_1091325424 18 Left 1091325419 11:134683384-134683406 CCCACCAGGAAATTCCACACGTG No data
Right 1091325424 11:134683425-134683447 TGTCGCCCATTGCAGTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091325419 Original CRISPR CACGTGTGGAATTTCCTGGT GGG (reversed) Intergenic