ID: 1091325422

View in Genome Browser
Species Human (GRCh38)
Location 11:134683398-134683420
Sequence CACAAGCAGATCAACACGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091325422_1091325429 20 Left 1091325422 11:134683398-134683420 CCACACGTGTTGATCTGCTTGTG No data
Right 1091325429 11:134683441-134683463 CTGTGGGCTCCTGGAGCTCAGGG No data
1091325422_1091325428 19 Left 1091325422 11:134683398-134683420 CCACACGTGTTGATCTGCTTGTG No data
Right 1091325428 11:134683440-134683462 TCTGTGGGCTCCTGGAGCTCAGG No data
1091325422_1091325423 3 Left 1091325422 11:134683398-134683420 CCACACGTGTTGATCTGCTTGTG No data
Right 1091325423 11:134683424-134683446 CTGTCGCCCATTGCAGTCTGTGG No data
1091325422_1091325424 4 Left 1091325422 11:134683398-134683420 CCACACGTGTTGATCTGCTTGTG No data
Right 1091325424 11:134683425-134683447 TGTCGCCCATTGCAGTCTGTGGG No data
1091325422_1091325427 11 Left 1091325422 11:134683398-134683420 CCACACGTGTTGATCTGCTTGTG No data
Right 1091325427 11:134683432-134683454 CATTGCAGTCTGTGGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091325422 Original CRISPR CACAAGCAGATCAACACGTG TGG (reversed) Intergenic