ID: 1091325424

View in Genome Browser
Species Human (GRCh38)
Location 11:134683425-134683447
Sequence TGTCGCCCATTGCAGTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091325421_1091325424 14 Left 1091325421 11:134683388-134683410 CCAGGAAATTCCACACGTGTTGA No data
Right 1091325424 11:134683425-134683447 TGTCGCCCATTGCAGTCTGTGGG No data
1091325420_1091325424 17 Left 1091325420 11:134683385-134683407 CCACCAGGAAATTCCACACGTGT No data
Right 1091325424 11:134683425-134683447 TGTCGCCCATTGCAGTCTGTGGG No data
1091325422_1091325424 4 Left 1091325422 11:134683398-134683420 CCACACGTGTTGATCTGCTTGTG No data
Right 1091325424 11:134683425-134683447 TGTCGCCCATTGCAGTCTGTGGG No data
1091325418_1091325424 19 Left 1091325418 11:134683383-134683405 CCCCACCAGGAAATTCCACACGT No data
Right 1091325424 11:134683425-134683447 TGTCGCCCATTGCAGTCTGTGGG No data
1091325419_1091325424 18 Left 1091325419 11:134683384-134683406 CCCACCAGGAAATTCCACACGTG No data
Right 1091325424 11:134683425-134683447 TGTCGCCCATTGCAGTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091325424 Original CRISPR TGTCGCCCATTGCAGTCTGT GGG Intergenic