ID: 1091325427

View in Genome Browser
Species Human (GRCh38)
Location 11:134683432-134683454
Sequence CATTGCAGTCTGTGGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091325420_1091325427 24 Left 1091325420 11:134683385-134683407 CCACCAGGAAATTCCACACGTGT No data
Right 1091325427 11:134683432-134683454 CATTGCAGTCTGTGGGCTCCTGG No data
1091325422_1091325427 11 Left 1091325422 11:134683398-134683420 CCACACGTGTTGATCTGCTTGTG No data
Right 1091325427 11:134683432-134683454 CATTGCAGTCTGTGGGCTCCTGG No data
1091325419_1091325427 25 Left 1091325419 11:134683384-134683406 CCCACCAGGAAATTCCACACGTG No data
Right 1091325427 11:134683432-134683454 CATTGCAGTCTGTGGGCTCCTGG No data
1091325418_1091325427 26 Left 1091325418 11:134683383-134683405 CCCCACCAGGAAATTCCACACGT No data
Right 1091325427 11:134683432-134683454 CATTGCAGTCTGTGGGCTCCTGG No data
1091325421_1091325427 21 Left 1091325421 11:134683388-134683410 CCAGGAAATTCCACACGTGTTGA No data
Right 1091325427 11:134683432-134683454 CATTGCAGTCTGTGGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091325427 Original CRISPR CATTGCAGTCTGTGGGCTCC TGG Intergenic