ID: 1091325428

View in Genome Browser
Species Human (GRCh38)
Location 11:134683440-134683462
Sequence TCTGTGGGCTCCTGGAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091325422_1091325428 19 Left 1091325422 11:134683398-134683420 CCACACGTGTTGATCTGCTTGTG No data
Right 1091325428 11:134683440-134683462 TCTGTGGGCTCCTGGAGCTCAGG No data
1091325421_1091325428 29 Left 1091325421 11:134683388-134683410 CCAGGAAATTCCACACGTGTTGA No data
Right 1091325428 11:134683440-134683462 TCTGTGGGCTCCTGGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091325428 Original CRISPR TCTGTGGGCTCCTGGAGCTC AGG Intergenic