ID: 1091330013

View in Genome Browser
Species Human (GRCh38)
Location 11:134724938-134724960
Sequence AAGTGTGGCCCGAGCGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091330010_1091330013 1 Left 1091330010 11:134724914-134724936 CCTCGTGGCTAAGATGGCATGAC No data
Right 1091330013 11:134724938-134724960 AAGTGTGGCCCGAGCGGAGACGG No data
1091330007_1091330013 21 Left 1091330007 11:134724894-134724916 CCAGAGCAGACAGGAAGGCACCT No data
Right 1091330013 11:134724938-134724960 AAGTGTGGCCCGAGCGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091330013 Original CRISPR AAGTGTGGCCCGAGCGGAGA CGG Intergenic
No off target data available for this crispr