ID: 1091334077

View in Genome Browser
Species Human (GRCh38)
Location 11:134753674-134753696
Sequence CAGGTAAGGAGAAGGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091334077_1091334082 17 Left 1091334077 11:134753674-134753696 CCCACAATCCTTCTCCTTACCTG No data
Right 1091334082 11:134753714-134753736 TTGTTGTGAAACTCTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091334077 Original CRISPR CAGGTAAGGAGAAGGATTGT GGG (reversed) Intergenic
No off target data available for this crispr