ID: 1091334202

View in Genome Browser
Species Human (GRCh38)
Location 11:134754344-134754366
Sequence CTGAATGAGCAGAAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091334202_1091334211 17 Left 1091334202 11:134754344-134754366 CCTTGCTCCTTCTGCTCATTCAG No data
Right 1091334211 11:134754384-134754406 GTTGCTTGTTGTAGGACTAAGGG No data
1091334202_1091334209 9 Left 1091334202 11:134754344-134754366 CCTTGCTCCTTCTGCTCATTCAG No data
Right 1091334209 11:134754376-134754398 GGAATTCAGTTGCTTGTTGTAGG No data
1091334202_1091334210 16 Left 1091334202 11:134754344-134754366 CCTTGCTCCTTCTGCTCATTCAG No data
Right 1091334210 11:134754383-134754405 AGTTGCTTGTTGTAGGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091334202 Original CRISPR CTGAATGAGCAGAAGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr