ID: 1091334365

View in Genome Browser
Species Human (GRCh38)
Location 11:134755324-134755346
Sequence GTCCAGATGCAGCATGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091334365_1091334371 11 Left 1091334365 11:134755324-134755346 CCCTGCTCATGCTGCATCTGGAC No data
Right 1091334371 11:134755358-134755380 TGTGAAGACCTTGTTTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091334365 Original CRISPR GTCCAGATGCAGCATGAGCA GGG (reversed) Intergenic
No off target data available for this crispr