ID: 1091334470

View in Genome Browser
Species Human (GRCh38)
Location 11:134755993-134756015
Sequence TGCCACCCTCGTTATGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091334464_1091334470 26 Left 1091334464 11:134755944-134755966 CCATTGTAGTTAGACTGTCACAG No data
Right 1091334470 11:134755993-134756015 TGCCACCCTCGTTATGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091334470 Original CRISPR TGCCACCCTCGTTATGTTGG GGG Intergenic
No off target data available for this crispr