ID: 1091337143

View in Genome Browser
Species Human (GRCh38)
Location 11:134780705-134780727
Sequence GAGAAGAAGGAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091337143_1091337150 5 Left 1091337143 11:134780705-134780727 CCCTCCTCTTTCTCCTTCTTCTC No data
Right 1091337150 11:134780733-134780755 TTAGGGGATTTCTTACCCACTGG No data
1091337143_1091337152 18 Left 1091337143 11:134780705-134780727 CCCTCCTCTTTCTCCTTCTTCTC No data
Right 1091337152 11:134780746-134780768 TACCCACTGGAGGTAAGTTTAGG No data
1091337143_1091337151 8 Left 1091337143 11:134780705-134780727 CCCTCCTCTTTCTCCTTCTTCTC No data
Right 1091337151 11:134780736-134780758 GGGGATTTCTTACCCACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091337143 Original CRISPR GAGAAGAAGGAGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr