ID: 1091345221

View in Genome Browser
Species Human (GRCh38)
Location 11:134847746-134847768
Sequence GAACCCTATGGGCCTTCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091345217_1091345221 1 Left 1091345217 11:134847722-134847744 CCTCACTGCTGCAGGCCTGCAGT No data
Right 1091345221 11:134847746-134847768 GAACCCTATGGGCCTTCCTAAGG No data
1091345214_1091345221 12 Left 1091345214 11:134847711-134847733 CCGGAGCCAGGCCTCACTGCTGC No data
Right 1091345221 11:134847746-134847768 GAACCCTATGGGCCTTCCTAAGG No data
1091345212_1091345221 30 Left 1091345212 11:134847693-134847715 CCTGGAGCTGCTGTCTCTCCGGA No data
Right 1091345221 11:134847746-134847768 GAACCCTATGGGCCTTCCTAAGG No data
1091345216_1091345221 6 Left 1091345216 11:134847717-134847739 CCAGGCCTCACTGCTGCAGGCCT No data
Right 1091345221 11:134847746-134847768 GAACCCTATGGGCCTTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091345221 Original CRISPR GAACCCTATGGGCCTTCCTA AGG Intergenic
No off target data available for this crispr