ID: 1091346574

View in Genome Browser
Species Human (GRCh38)
Location 11:134858182-134858204
Sequence CACTGACGGCAGCCTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091346570_1091346574 1 Left 1091346570 11:134858158-134858180 CCGGGAAGTTGTATATGTTCTCT No data
Right 1091346574 11:134858182-134858204 CACTGACGGCAGCCTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091346574 Original CRISPR CACTGACGGCAGCCTGGGAC AGG Intergenic
No off target data available for this crispr