ID: 1091351745

View in Genome Browser
Species Human (GRCh38)
Location 11:134903369-134903391
Sequence CCAATATTCTAGGGAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091351745_1091351753 9 Left 1091351745 11:134903369-134903391 CCAGCACCTCCCTAGAATATTGG No data
Right 1091351753 11:134903401-134903423 CCCAAGAGAACAACCTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091351745 Original CRISPR CCAATATTCTAGGGAGGTGC TGG (reversed) Intergenic
No off target data available for this crispr