ID: 1091352533

View in Genome Browser
Species Human (GRCh38)
Location 11:134908599-134908621
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091352526_1091352533 19 Left 1091352526 11:134908557-134908579 CCTCAGGGATCTCTGCAGTTAAG No data
Right 1091352533 11:134908599-134908621 ATAAGGCTCTTCCGCAGTGCAGG No data
1091352530_1091352533 -10 Left 1091352530 11:134908586-134908608 CCCTTGGCCATACATAAGGCTCT No data
Right 1091352533 11:134908599-134908621 ATAAGGCTCTTCCGCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091352533 Original CRISPR ATAAGGCTCTTCCGCAGTGC AGG Intergenic