ID: 1091353162

View in Genome Browser
Species Human (GRCh38)
Location 11:134913822-134913844
Sequence TGCACCAGCCCTCAGGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091353162_1091353166 -9 Left 1091353162 11:134913822-134913844 CCACAGTCCTGAGGGCTGGTGCA No data
Right 1091353166 11:134913836-134913858 GCTGGTGCAGTGGCAGCAGAGGG No data
1091353162_1091353165 -10 Left 1091353162 11:134913822-134913844 CCACAGTCCTGAGGGCTGGTGCA No data
Right 1091353165 11:134913835-134913857 GGCTGGTGCAGTGGCAGCAGAGG No data
1091353162_1091353167 3 Left 1091353162 11:134913822-134913844 CCACAGTCCTGAGGGCTGGTGCA No data
Right 1091353167 11:134913848-134913870 GCAGCAGAGGGATAAACAGCAGG No data
1091353162_1091353168 14 Left 1091353162 11:134913822-134913844 CCACAGTCCTGAGGGCTGGTGCA No data
Right 1091353168 11:134913859-134913881 ATAAACAGCAGGCGACTCTGTGG No data
1091353162_1091353171 29 Left 1091353162 11:134913822-134913844 CCACAGTCCTGAGGGCTGGTGCA No data
Right 1091353171 11:134913874-134913896 CTCTGTGGGTACAGAGATATGGG No data
1091353162_1091353169 15 Left 1091353162 11:134913822-134913844 CCACAGTCCTGAGGGCTGGTGCA No data
Right 1091353169 11:134913860-134913882 TAAACAGCAGGCGACTCTGTGGG No data
1091353162_1091353170 28 Left 1091353162 11:134913822-134913844 CCACAGTCCTGAGGGCTGGTGCA No data
Right 1091353170 11:134913873-134913895 ACTCTGTGGGTACAGAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091353162 Original CRISPR TGCACCAGCCCTCAGGACTG TGG (reversed) Intergenic