ID: 1091353164

View in Genome Browser
Species Human (GRCh38)
Location 11:134913829-134913851
Sequence CTGCCACTGCACCAGCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091353164_1091353168 7 Left 1091353164 11:134913829-134913851 CCTGAGGGCTGGTGCAGTGGCAG No data
Right 1091353168 11:134913859-134913881 ATAAACAGCAGGCGACTCTGTGG No data
1091353164_1091353170 21 Left 1091353164 11:134913829-134913851 CCTGAGGGCTGGTGCAGTGGCAG No data
Right 1091353170 11:134913873-134913895 ACTCTGTGGGTACAGAGATATGG No data
1091353164_1091353171 22 Left 1091353164 11:134913829-134913851 CCTGAGGGCTGGTGCAGTGGCAG No data
Right 1091353171 11:134913874-134913896 CTCTGTGGGTACAGAGATATGGG No data
1091353164_1091353169 8 Left 1091353164 11:134913829-134913851 CCTGAGGGCTGGTGCAGTGGCAG No data
Right 1091353169 11:134913860-134913882 TAAACAGCAGGCGACTCTGTGGG No data
1091353164_1091353167 -4 Left 1091353164 11:134913829-134913851 CCTGAGGGCTGGTGCAGTGGCAG No data
Right 1091353167 11:134913848-134913870 GCAGCAGAGGGATAAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091353164 Original CRISPR CTGCCACTGCACCAGCCCTC AGG (reversed) Intergenic